
                                 degapseq 



Function

   Removes gap characters from sequences

Description

   degapseq reads in one or more sequences and writes them out again
   minus any gap characters. In effect it removes gaps from aligned
   sequences.

   In fact, if does more than just this as it removes ANY non-alphabetic
   character from the input sequence, so as well as removing the
   gap-characters, it will remove such things as the '*' in protein
   sequences that indicates the position of a 'translated' STOP codon.

   There are many different formats for storing sequences in files. Some
   sequence formats allow you to store aligned sequences, including the
   information on where gaps have been introduced to make the sequence
   align properly. This is indicated by using a special character to
   indicate that there is a gap at that position. Different sequence
   formats use different characters to indicate gaps. Some formats may
   use more than one type of character to indicate different types of
   gaps (e.g. gaps at the ends of the sequences, internal gaps, gaps
   introduced by a program or by a person editing the alignment, etc.)
   Some typicate characters used to indicate where gaps are may be: '.',
   '-' and '~'.

   When EMBOSS programs read in a sequence that has gap-characters in,
   all gap characters are internally changed to '-' characters. i.e.
   EMBOSS only has one type of gap character. Thus any distinguishing
   characters for different gap types are reduced to a '-'. There is only
   one type of gap in EMBOSS.

   degapseq removes any non-alphabetic character in the sequence, in
   effect this means that gaps and '*' characters are removed. The
   sequence is then written out.

Usage

   Here is a sample session with degapseq


% degapseq dnagap.fasta nogaps.seq 
Removes gap characters from sequences

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqoutall  [.] Sequence set(s)
                                  filename and optional format (output USA)

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   Any valid input sequence USA is allowed.

   The input sequence can be nucleic or protein.

   The input sequence can be gapped or ungapped.

  Input files for usage example

  File: dnagap.fasta

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGT....ACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGT

Output file format

   The output is a sequence with no gaps.

  Output files for usage example

  File: nogaps.seq

>FASTA F10002 FASTA FORMAT DNA SEQUENCE
ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT
ACGTACGTACGTACGTACGTACGTACGTACGTACGT

Data files

   None.

Notes

   None.

References

   None.

Warnings

   It will remove '*' characters from protein sequences as well as
   removing the gap characters.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name                         Description
   biosed       Replace or delete sequence sections
   codcopy      Reads and writes a codon usage table
   cutseq       Removes a specified section from a sequence
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractalign Extract regions from a sequence alignment
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Write a list file of the logical OR of two sets of sequences
   makenucseq   Creates random nucleotide sequences
   makeprotseq  Creates random protein sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Exclude a set of sequences and write out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   union        Reads sequence fragments and builds one sequence
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file

Author(s)

   Gary Williams (gwilliam  rfcgr.mrc.ac.uk)
   MRC Rosalind Franklin Centre for Genomics Research Wellcome Trust
   Genome Campus, Hinxton, Cambridge, CB10 1SB, UK

History

   Written (6 March 2001) - Gary Williams

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
