
                                   union 



Function

   Reads sequence fragments and builds one sequence

Description

   union reads in several sequences, concatenates them and writes them
   out as a single sequence.

   It is most useful when the input sequences are specified in a List
   file. The List file (file of sequence names) can be any set of
   sequences in files or database entries specified in the normal EMBOSS
   USA (which can include the spcification of sub-regions of the
   sequence, eg. 'em:hsfau[20,55]'). Specifying several such subregions
   in a sequence or sequences allows you to enter disjoint sequences to
   be joined.

Usage

   Here is a sample session with union

   The file 'cds.list' contains a list of the regions making up the
   coding sequence of 'embl:x65923':


% union 
Reads sequence fragments and builds one sequence
Input (gapped) sequence(s): @cds.list
output sequence [x65921.fasta]: 

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          seqall     (Gapped) sequence(s) filename and optional
                                  format, or reference (input USA)
  [-outseq]            seqout     [.] Sequence filename and
                                  optional format (output USA)

   Additional (Optional) qualifiers:
   -overlapfile        outfile    [*.union] Sequence overlaps output file
                                  (optional)

   Advanced (Unprompted) qualifiers:
   -feature            boolean    [N] Use feature information
   -source             boolean    [N] Create source features
   -findoverlap        boolean    [N] Look for overlaps when joining

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of each sequence to be used
   -send1              integer    End of each sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outseq" associated qualifiers
   -osformat2          string     Output seq format
   -osextension2       string     File name extension
   -osname2            string     Base file name
   -osdirectory2       string     Output directory
   -osdbname2          string     Database name to add
   -ossingle2          boolean    Separate file for each entry
   -oufo2              string     UFO features
   -offormat2          string     Features format
   -ofname2            string     Features file name
   -ofdirectory2       string     Output directory

   "-overlapfile" associated qualifiers
   -odirectory         string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report dying program messages

Input file format

   The input can be any set of sequences in a file of multiple sequence
   entries or in a List file. The sequences are concatenated in the order
   in which they appear in the file.

  Input files for usage example

  File: cds.list

tembl-id:X65921[782:856]
tembl-id:X65921[951:1095]
tembl-id:X65921[1557:1612]
tembl-id:X65921[1787:1912]

   You may find the program yank useful for creating List files.

Output file format

  Output files for usage example

  File: x65921.fasta

>X65921 X65921.1 H.sapiens fau 1 gene
atgcagctctttgtccgcgcccaggagctacacaccttcgaggtgaccggccaggaaacg
gtcgcccagatcaaggctcatgtagcctcactggagggcattgccccggaagatcaagtc
gtgctcctggcaggcgcgcccctggaggatgaggccactctgggccagtgcggggtggag
gccctgactaccctggaagtagcaggccgcatgcttggaggtaaagtccatggttccctg
gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag
aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg
cccacctttggcaagaagaagggccccaatgccaactcttaa

   The result is a normal sequence file containing a single sequence
   resulting from the concatenation of the input sequences.

Data files

   None.

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with status 0.

Known bugs

   None.

See also

   Program name                         Description
   biosed       Replace or delete sequence sections
   codcopy      Reads and writes a codon usage table
   cutseq       Removes a specified section from a sequence
   degapseq     Removes gap characters from sequences
   descseq      Alter the name or description of a sequence
   entret       Reads and writes (returns) flatfile entries
   extractalign Extract regions from a sequence alignment
   extractfeat  Extract features from a sequence
   extractseq   Extract regions from a sequence
   listor       Write a list file of the logical OR of two sets of sequences
   makenucseq   Creates random nucleotide sequences
   makeprotseq  Creates random protein sequences
   maskfeat     Mask off features of a sequence
   maskseq      Mask off regions of a sequence
   newseq       Type in a short new sequence
   noreturn     Removes carriage return from ASCII files
   notseq       Exclude a set of sequences and write out the remaining ones
   nthseq       Writes one sequence from a multiple set of sequences
   pasteseq     Insert one sequence into another
   revseq       Reverse and complement a sequence
   seqret       Reads and writes (returns) sequences
   seqretsplit  Reads and writes (returns) sequences in individual files
   skipseq      Reads and writes (returns) sequences, skipping first few
   splitter     Split a sequence into (overlapping) smaller sequences
   trimest      Trim poly-A tails off EST sequences
   trimseq      Trim ambiguous bits off the ends of sequences
   vectorstrip  Strips out DNA between a pair of vector sequences
   yank         Reads a sequence range, appends the full USA to a list file

   You may find the program yank useful for creating List files.

Author(s)

   Peter Rice (pmr  ebi.ac.uk)
   Informatics Division, European Bioinformatics Institute, Wellcome
   Trust Genome Campus, Hinxton, Cambridge CB10 1SD, UK

History

   Written (March 2002) - Peter Rice.

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
